View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707_low_40 (Length: 246)
Name: NF1707_low_40
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707_low_40 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 43456392 - 43456163
Alignment:
| Q |
17 |
acaatttgtacccaactgtaacgtgccaactttaatgtgtttcttatcccaaatttctacaacacctcccttgcaccccaaataaattaattctgaactc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43456392 |
acaatttgtacccaactgtaacgtgccaactttaatgtgtttcttatcccaaatttctacaacacctcccttgcaccccaaataaattaattctgaactc |
43456293 |
T |
|
| Q |
117 |
actgccatagcccgcacttctgatccagtttgcagtgatccaaccatgctgtaattggaattgttccatatcttgacgtatatgtaaaacagtcagttaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43456292 |
actgccatagcccgcacttctgatccagtttgcagtgatccaaccatgctgtaattggaattattccatatcttgacgtatatgtaaaacagtcagttaa |
43456193 |
T |
|
| Q |
217 |
ctatggtacgaacatccagaaagttaatat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43456192 |
ctatggtacgaacatccagaaagttaatat |
43456163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University