View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1708-Insertion-5 (Length: 371)
Name: NF1708-Insertion-5
Description: NF1708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1708-Insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 13 - 143
Target Start/End: Complemental strand, 52161071 - 52160941
Alignment:
| Q |
13 |
atcaagaatttgttgattgatgtgttctgttttggggtcaaccaaatttcttgaaattgacttgttttcttttgcgttgtgtttcatttcttattggtgg |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52161071 |
atcaagaaattgttgattgatgtgttctgttttggggtcaaccaaatttcttgaaattgacttgttttcttttgcgttgtgtttcatttcttattggtgg |
52160972 |
T |
|
| Q |
113 |
aaattggaatgaccgaaacaaataaattgga |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52160971 |
aaattggaatgaccgaaacaaataaattgga |
52160941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 179 - 366
Target Start/End: Complemental strand, 52160903 - 52160724
Alignment:
| Q |
179 |
ggaatgactgaaacaaataatatggcatgatcgttagtaattttgtgaattttttaacgcaggcaaatactgtttttggtgcgttgcggggattagaggt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52160903 |
ggaatgactgaaacaaataatatggcatgatcgttagtaattttgtgaattttttaacgcaggcaaatactgtttttggtgcgttgcggggattagaggt |
52160804 |
T |
|
| Q |
279 |
atgtgtaaaatttgcaactcatttttgtgaattcatctcannnnnnnncctatattctaaaaatgaaatgtgattcatctcatttttt |
366 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
52160803 |
atgtgtaaaatttgcaactca--------aattcatctcattttttttcttatattctaaaaatgagatgtgattcatctaatttttt |
52160724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 17348 times since January 2019
Visitors: 1266