View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_high_21 (Length: 409)
Name: NF17080_high_21
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 362
Target Start/End: Original strand, 10501045 - 10501394
Alignment:
| Q |
18 |
ggtggaggaggttaaggtgttgtcctggcgttggggctatggaacggataaaaattcagccgtgtttcttttatgaacggtgttggaatccgatgttttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
10501045 |
ggtggaggaggttaaggtgttgtcctggcgttggggctatggaacggatgaaaattcagccgtgtttcttttatgaacggtgttggaatccgaggtttcg |
10501144 |
T |
 |
| Q |
118 |
tatggtgagatagcctctgcccgagccgg-gtgaagagggggtttttggttatttcttggtctgaccaggtttttgt---tgcgggatttgcggacctgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10501145 |
tatggtgagatagcctctgcccgagccgcagtgaagagggggtttttggttatttctcggtctgaccaggtttttgttgttgcgggatttgcggacctgt |
10501244 |
T |
 |
| Q |
214 |
ctgttactgtgttgttgtttttgagctgttgcaggtctggtgcggtagcagtgtggtgaccagaattgtagcaatttccgctgcgggtctgatgtgctcc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
10501245 |
ctgttactgtgttgttgtttttgagctgttgcaggtctggtgcggcagcagtgtggtgaccagaattgtagcaatttccactgcggctctgatgtgctcc |
10501344 |
T |
 |
| Q |
314 |
tgcag-ttttccgttggtgctcgggtggagtatgctgttgtgggatttag |
362 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10501345 |
tgcagtttttcggttggtgctcgggtggagtatgctgttatgggatttag |
10501394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 339 - 400
Target Start/End: Original strand, 10501411 - 10501472
Alignment:
| Q |
339 |
ggagtatgctgttgtgggatttagggagaaactgttagnnnnnnnctttgttagagaattat |
400 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10501411 |
ggagtatgctgttatgggatttagggagaaactgttagtttttttctttgttagagaattat |
10501472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University