View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_high_31 (Length: 370)
Name: NF17080_high_31
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 151 - 360
Target Start/End: Complemental strand, 19644090 - 19643881
Alignment:
| Q |
151 |
aatggcaaatatatataaagaagatacggaagatacaatgtacaaaggatgaaaatgattgtctaatggacaaaattagacaatgaatttgaaggaaaaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19644090 |
aatggcaaatatatataaagaagatacggaagatacaatgtacaaaggatgaaaatgattgtctaatggacaaaattagacaatgaatttgaaggaaaaa |
19643991 |
T |
 |
| Q |
251 |
tgataatatgaaaggttagcaacaatgaacaaacagtaaatagatatatttgttatggcctttgcaagaatagtaaacaaacccgttgatttagcactta |
350 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19643990 |
taataatatgaaaggttagcaacaatgaacaaacagtaaatagatatatttgttatggcctttgcaagaatagtaaacaaacccgttgatttagcactta |
19643891 |
T |
 |
| Q |
351 |
tctccctatg |
360 |
Q |
| |
|
| ||| |||| |
|
|
| T |
19643890 |
tttccttatg |
19643881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 21 - 106
Target Start/End: Complemental strand, 19644425 - 19644340
Alignment:
| Q |
21 |
tgcatgcatgcggttaccatttagtttgaacatatgagaacatgataatcactgttaattgtattccttatatgactacccagatg |
106 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
19644425 |
tgcatgcatgcggttaccatttagcttgaacatatgaaaacatgataatcattgttaattgtgttccttatttgactacccagatg |
19644340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University