View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_high_53 (Length: 286)
Name: NF17080_high_53
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_high_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 51 - 269
Target Start/End: Complemental strand, 49123539 - 49123321
Alignment:
| Q |
51 |
taatattatttcaccgcatatgcattggtttgacatgttgctacttgctaagctttcaaaacaatcatatcttagatatagtttcaattggaccccctca |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49123539 |
taatattatttcaccgcatatgcattggtttgacatgttgctacttgctaagctttcaaaacaatcatatcttagatattgtttcaattggaccccctca |
49123440 |
T |
|
| Q |
151 |
ttgaattcaattacgtcatgaacttagggtggttttaattttgaaaataaattatatgtacatttttgtccttatcttggtcatacacctgccatataca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49123439 |
ttgaattcaattacgtcatgaacttagggtggttttaattttgaaaataaattatatgtacatttttgtccttatcttggtcatacacctgccatataca |
49123340 |
T |
|
| Q |
251 |
ttttctaaactgactatgt |
269 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
49123339 |
ttttctaaactgactatgt |
49123321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 49123819 - 49123778
Alignment:
| Q |
11 |
agaatatcttttagatggtaatgccaactaaacttgttatta |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49123819 |
agaatatcttttagatggtaatgccaactaaacttgttatta |
49123778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University