View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_high_69 (Length: 246)
Name: NF17080_high_69
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_high_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 30 - 209
Target Start/End: Original strand, 8320354 - 8320531
Alignment:
| Q |
30 |
agtattgatttagtgagatggccatgtgaagtgtggaatggagtcctgaacttcacccttagttatgcaatatttcaatgaacaataataaatttcttaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
8320354 |
agtattgatttagtgagatggccatgtgaagtgtggaatggagtcctgaacttcacccttagttatgcaatatttcaatgagc---aataaatttcttaa |
8320450 |
T |
 |
| Q |
130 |
tactatgcacatgaggaacataaatattttgcatcaaaacattagtaagaggaattattttg-tttacatagacattgtaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
8320451 |
tactatgcacatgaggaacataaatattttgcatcaaaacattagtaagaggaatttttttgttttacatagatattgtaa |
8320531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University