View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17080_high_69 (Length: 246)

Name: NF17080_high_69
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17080_high_69
NF17080_high_69
[»] chr4 (1 HSPs)
chr4 (30-209)||(8320354-8320531)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 30 - 209
Target Start/End: Original strand, 8320354 - 8320531
Alignment:
30 agtattgatttagtgagatggccatgtgaagtgtggaatggagtcctgaacttcacccttagttatgcaatatttcaatgaacaataataaatttcttaa 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |   ||||||||||||||    
8320354 agtattgatttagtgagatggccatgtgaagtgtggaatggagtcctgaacttcacccttagttatgcaatatttcaatgagc---aataaatttcttaa 8320450  T
130 tactatgcacatgaggaacataaatattttgcatcaaaacattagtaagaggaattattttg-tttacatagacattgtaa 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||    
8320451 tactatgcacatgaggaacataaatattttgcatcaaaacattagtaagaggaatttttttgttttacatagatattgtaa 8320531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University