View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_high_77 (Length: 238)
Name: NF17080_high_77
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_high_77 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 57 - 224
Target Start/End: Original strand, 2832522 - 2832689
Alignment:
| Q |
57 |
gtctataacatgaaaaatctccagtttcttcaaacaacctttgccaaactctgattctatgttgtagcgttctggttatatttatatttcgttaattaat |
156 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2832522 |
gtctataacatgaaaaatctccactttcttcaaacaacctttgccaaactctgattctatgttgtagcgttctggttatatttatatttcgttaattaat |
2832621 |
T |
|
| Q |
157 |
tgtattgttttagggctgaatgaataggcttcttcagaaaaaaggtgttgaattttggcttctttagg |
224 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2832622 |
tgaattgttttagggctgaatgaataggcttcttcagaaaaaagttgttgaattttggcttctttagg |
2832689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University