View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_high_78 (Length: 237)
Name: NF17080_high_78
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_high_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 53682724 - 53682940
Alignment:
| Q |
1 |
atcatcgccaacacaatagccccttagacctaacaaatttttgtgcctaacccttccaagcacttcaacttctacagcaaattccatctctgcctttgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682724 |
atcatcgccaacacaatagccccttagacctaacaaatttttgtgcctaacccttccaagcacttcaacttctacagcaaattccatctctgcctttgag |
53682823 |
T |
 |
| Q |
101 |
ttcattgctttcagtttcttcactgctatctgtaatttccaatgaaaagagagttaatggcaaagacaaggactttgtcacttcatattaaagacatgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682824 |
ttcattgctttcagtttcttcactgctatctgtaatttccaatgaaaagagagttaatggcaaagacaaggactttgtcacttcatattaaagacatgtt |
53682923 |
T |
 |
| Q |
201 |
ccgtgtccgatatgtgt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53682924 |
ccgtgtccgatatgtgt |
53682940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 98
Target Start/End: Original strand, 46146645 - 46146714
Alignment:
| Q |
29 |
cctaacaaatttttgtgcctaacccttccaagcacttcaacttctacagcaaattccatctctgcctttg |
98 |
Q |
| |
|
||||||||||| || ||||| |||||||| || ||||| ||||| || ||||||||||||||||| |||| |
|
|
| T |
46146645 |
cctaacaaattcttatgcctcacccttcctagtacttccacttcaactgcaaattccatctctgcttttg |
46146714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University