View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_high_87 (Length: 217)
Name: NF17080_high_87
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_high_87 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 35 - 181
Target Start/End: Complemental strand, 51731432 - 51731283
Alignment:
| Q |
35 |
tagaaggtatgaataatgtattgttgaaattgaacaaaaaatgggaatagaa---ttcccccaacataaaggaattctccttcctttcactcacaatatc |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
51731432 |
tagaaggtatgaataatgtattgttgaaattgaacaaaaaatgggaatagaagaattcccccaacgtaaaggaattttccttcctttcactcacaatatc |
51731333 |
T |
 |
| Q |
132 |
aggtgtaaagcatacctcactctgttatagtttccccaatttatacacaa |
181 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51731332 |
agatgtaaagcatacctcactctgttatagtttccccaatttatacacaa |
51731283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University