View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_high_89 (Length: 207)
Name: NF17080_high_89
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_high_89 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 1637278 - 1637454
Alignment:
| Q |
18 |
gttttcacaagcgcaacgtcgattggagcaccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggt |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1637278 |
gttttcacaagggcaacgtcgattggagcaccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggt |
1637377 |
T |
|
| Q |
118 |
tcttggcttggcctgaggcttggaaaagggtggtcaagagtatgccactgcccacagcttcactgagcttcatctca |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1637378 |
tcttggcttggcctgaggcttggaaaagggtggtcaagagtatgccactgcccacagcttcactgagcttcttctca |
1637454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 32 - 155
Target Start/End: Original strand, 1612687 - 1612810
Alignment:
| Q |
32 |
aacgtcgattggagcaccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcct |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||| ||||| |||| | || | |||||||||||| |||||||||||| | ||| |||| |
|
|
| T |
1612687 |
aacgtcgattggagcaccactcacagcagatccaatggccaaatcaccgtcactagtgcgattaaccttaaggtacccttgttggtccacggcgatgcct |
1612786 |
T |
|
| Q |
132 |
gaggcttggaaaagggtggtcaag |
155 |
Q |
| |
|
|||| |||| |||||||||||||| |
|
|
| T |
1612787 |
gaggattggtaaagggtggtcaag |
1612810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 32 - 158
Target Start/End: Original strand, 1629223 - 1629349
Alignment:
| Q |
32 |
aacgtcgattggagcaccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcct |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||| ||||| |||| | || | |||||||||||| |||||||||||| | ||| |||| |
|
|
| T |
1629223 |
aacgtcgattggagcaccactcacagcagatccaatggccaaatcaccgtcactagtgcgattaaccttaaggtacccttgttggtccacggcgatgcct |
1629322 |
T |
|
| Q |
132 |
gaggcttggaaaagggtggtcaagagt |
158 |
Q |
| |
|
|||| |||| |||||||| |||||||| |
|
|
| T |
1629323 |
gaggattggtaaagggtgatcaagagt |
1629349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 32 - 158
Target Start/End: Original strand, 1622155 - 1622281
Alignment:
| Q |
32 |
aacgtcgattggagcaccactcacagcagatccaaagtccatctcaccctcaccaatgagtttaaccttaaggaacccttgttggttcttggcttggcct |
131 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| | ||| ||||| |||| | || | |||||||||||| |||||||||||| | ||| |||| |
|
|
| T |
1622155 |
aacgtcgatgggagcaccactcacagcagatccaatggccaaatcaccgtcactagtgcgattaaccttaaggtacccttgttggtccacggcgatgcct |
1622254 |
T |
|
| Q |
132 |
gaggcttggaaaagggtggtcaagagt |
158 |
Q |
| |
|
|||| |||| |||||||| |||||||| |
|
|
| T |
1622255 |
gaggattggtaaagggtgatcaagagt |
1622281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University