View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_low_37 (Length: 342)
Name: NF17080_low_37
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 286
Target Start/End: Complemental strand, 37954862 - 37954586
Alignment:
| Q |
8 |
tagcaaagggaatcatattttttgttagttctcacctattcatagatgtaccgtcatgtatctgtaccagaatttctaatgaaaattgagatgcattagg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
37954862 |
tagcaaagggaatcatattttttgttagctctcacctattcatagatgtaccgtcat--atctgtacaaga-tttctaatgaaaattgagatgcattagg |
37954766 |
T |
 |
| Q |
108 |
ttaaaaaattactaacggtannnnnnn-gaccgattgtaaagaatgacaataacaatgttatttaagtatttcttattatcaatatattttcaacatagc |
206 |
Q |
| |
|
||||||||||||| || ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37954765 |
ttaaaaaattactgacagtattttttttgaccgattgtaaagaatgaccataacaatgttatttaagtatttcttattatcaatatattttcaacatagc |
37954666 |
T |
 |
| Q |
207 |
aagcagaggagaccattgattcaatagcaatcttttgaataaatttgggatttcaattatttatatgcaaaatagaacac |
286 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37954665 |
aagcataggagaccattgattcaatagcaatcttttgaataaatttgggatttcaaccatttatatgcaaaatagaacac |
37954586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University