View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_low_38 (Length: 339)
Name: NF17080_low_38
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 6227085 - 6227410
Alignment:
| Q |
1 |
tacaggtttcggcaatgagcttgagtttccattaccttgtccaacacgttgttgtcatactgtttatcatccagttattcgtgttgattatacacctccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227085 |
tacaggtttcggcaatgagcttgagtttccattaccttgtccaacacgttgttgtcatactgtttatcatccagttattcgtgttgattatacacctccg |
6227184 |
T |
|
| Q |
101 |
attgcgggtatgtttgtaccctcatacctgaaggcttttgtgaaagagatgactactctgtcctccgatgacaagaacaagaattcttttctggtagtcg |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6227185 |
attgcgggtatgtttgtacctccatacctgaaggcttttgtgaaagagatgactactctgtcctccgatgacaagaacaagaattcttttctggtagtag |
6227284 |
T |
|
| Q |
201 |
taggcaacctcccgcccgagacaaggaaccatgatttgcttcaacttttccagccttttggtcatgtcatcggtgccgatgttgctattgctcatcacac |
300 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
6227285 |
gaggcaacctcccacccgagacaaggaaccatgatttgcttcaacttttccagccttttggtcatgtcatcggtgccgatattgctattgctcaacacac |
6227384 |
T |
|
| Q |
301 |
tggccttagtggccgttttgcctttg |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6227385 |
tggccttagtggccgttttgcctttg |
6227410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University