View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_low_44 (Length: 329)
Name: NF17080_low_44
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_low_44 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 61 - 329
Target Start/End: Original strand, 8320023 - 8320293
Alignment:
| Q |
61 |
gtggtggcagtactctttgtaataattcattaatattctctttctctctttttaggtaagggacaaaatatagtatctctcttaagcactccttccatgt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8320023 |
gtggtggcagtactctttgtaataattcattaatattctctctctctctttttaggtaagggacaaaatatagtatctctcttaagcactccttccatgt |
8320122 |
T |
 |
| Q |
161 |
gcaatgtgaatatgtgagatttattgagagagaaagctacaagttcattaaggttgcctttcttttaatccatttatcatcatttccatgattgattgga |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8320123 |
gcaatgtgaatatgtgagatttattgagagacaaagctacaagttcattaaggttgcctttcttttaatccatttatcatcatttccatgattgattaga |
8320222 |
T |
 |
| Q |
261 |
gttaaacctaagttgaactttgtacatattttat--ttatatcatatcttttattataaatatttagagca |
329 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8320223 |
gttaaacctaagcttaactttgtacatattttattgttatatcatatcttttattataaatatttagagca |
8320293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University