View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_low_45 (Length: 325)
Name: NF17080_low_45
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 108 - 306
Target Start/End: Complemental strand, 6704789 - 6704591
Alignment:
| Q |
108 |
atgtgttggtaagaagtacatttctaggaagttgtcttccatttctgttttacttgagtttcaaactcatgtaaattgtgaatagagttaaggtgtttgt |
207 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6704789 |
atgtgttggtaagaagtacatttcttggaagttgtcttccatttctgttttatttgagtttgaaactcatgtaaattgtgaatagagttaaggtgtttgt |
6704690 |
T |
 |
| Q |
208 |
ctattgaactcaacgcatatatataattatgtgacttctactacatagggcattaggtttgtgtattaagtttggtggaagtggaattcatgtattatc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6704689 |
ctattgaactcaacgcatatatataattatgtgacttctactacatagggcattaggtttgtgtattaagtttggtggaagtggaattcatgtattatc |
6704591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 6704870 - 6704797
Alignment:
| Q |
1 |
gattgcatatataggaatgtctgaaaaggtaatagaatgtgtttttcaccaaaagtagattaaaatgggaagct |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6704870 |
gattgcatatataggaatgtctgaaaaggtaatagaatgtgtttttcaccaaaagtatattaaaatgggaagct |
6704797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University