View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_low_64 (Length: 251)
Name: NF17080_low_64
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_low_64 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 83 - 251
Target Start/End: Original strand, 12859336 - 12859504
Alignment:
| Q |
83 |
aatgtgagtatatcatcctttaatttcaaannnnnnnnnnnncagatttgtttagttgaaaatttctggttaatgcactttgtagcaccgacacgtttga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12859336 |
aatgtgagtatatcatcctttaatttcaaattttttatttttcagatttgtttaaatgaaaatttctggttaatgcactttgtagcaccgacacatttga |
12859435 |
T |
|
| Q |
183 |
ttgagggcgtctttgatgtttgacatctgtcggtgtccgacaacaacttaacattgacacatgcgatta |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12859436 |
ttgagggcgtctttgatgtttgacatctgtcggtgtccgacaacaacttaacattgacacatgcgatta |
12859504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 14 - 90
Target Start/End: Original strand, 12858892 - 12858968
Alignment:
| Q |
14 |
atatgcttttatgctgctttagctttgagacatgcnnnnnnncttctggtagaaagtgaccagcatgctaatgtgag |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12858892 |
atatgcttttatgctgctttagctttgagacatgctttttttcttctggtagaaagtgatcagcatgctaatgtgag |
12858968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University