View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_low_70 (Length: 246)
Name: NF17080_low_70
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_low_70 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 35601685 - 35601848
Alignment:
| Q |
1 |
tttgatttgccaagtaagaacaaccccaaagagcctttaaaacacatattataccccaatatatagttgttgttcaaaatggaggcttcaatgttgcact |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35601685 |
tttgatttgccaagtaagaacaacctcaaagagcctttaaaacacatattataccccaatatatagttgttgttcaaaacggaggcttcaatgttgcact |
35601784 |
T |
|
| Q |
101 |
ttatcatgcccatcgtcggtctggaccaactttacggatatcttgatttttgctctttgcatat |
164 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35601785 |
ttatcatgcctatcgtcggtctggaccaactttacggatatcatgatttttgctctttgcatat |
35601848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 35639329 - 35639166
Alignment:
| Q |
1 |
tttgatttgccaagtaagaacaaccccaaagagcctttaaaacacatattataccccaatatatagttgttgttcaaaatggaggcttcaatgttgcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35639329 |
tttgatttgccaagtaagaacaaccccaaagagcctttaaaacacatattataccccaatatatagttgttgttcaaaatggaggcttcaatgttgcact |
35639230 |
T |
|
| Q |
101 |
ttatcatgcccatcgtcggtctggaccaactttacggatatcttgatttttgctctttgcatat |
164 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
35639229 |
ttatcatgcctatcgtcggtctggatcaactttacggatatcatgatttttgctctttgtatat |
35639166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 159 - 224
Target Start/End: Original strand, 35602805 - 35602870
Alignment:
| Q |
159 |
gcatattgcttttatctgtttagtgaatccattgctcaagtgacaatggacatgggagtggtgtta |
224 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35602805 |
gcatatttcttttatctgtttagtgaatccattgctcaagtgacaatggacatgggagtggtgtta |
35602870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University