View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_low_73 (Length: 243)
Name: NF17080_low_73
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_low_73 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 223
Target Start/End: Complemental strand, 37331810 - 37331601
Alignment:
| Q |
15 |
gaatatatgtagcattcaaacgtaagtctttttggcttgtgcttatgtgaaaggtagttgttttaagtactgctgtaatacgttttgcttatcactttaa |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37331810 |
gaatatatgtagcattcaaacgtatgtctttttggcttgtgcttatgtgaaaggtagttgttttaagtactgctgtaatacgttttgcttatcactttaa |
37331711 |
T |
|
| Q |
115 |
ttttggatattaacttcttagagaattggctagaacgacaaccgagtaacatcattaaacaattgta-tttctggacaattaaaaagctcaagagatcaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37331710 |
ttttggatattaacttcttagagaattggctagaacgacaaccgagtaacatcattaaacaattgtattttctggacaattaaaaagctcaagagatcaa |
37331611 |
T |
|
| Q |
214 |
agattgcgta |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
37331610 |
agattgcgta |
37331601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University