View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_low_77 (Length: 239)
Name: NF17080_low_77
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_low_77 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 42 - 239
Target Start/End: Complemental strand, 33690982 - 33690785
Alignment:
| Q |
42 |
ttgaagatccttttttagttgacgttcaatggacttatggttcgagatttttgcttcgttcaaaactacttgtcttgcgcaacttgattgaaacacacta |
141 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33690982 |
ttgaagatccatttttagttgacgttcaatggacttatagatagagatttttgcttcgttcaaaactacttgtcttgcgcaacttgattgaaacacagta |
33690883 |
T |
|
| Q |
142 |
ggaccacattatatgatttcaatcatttgtcagctgtcattcttatgagaaatccctggattcacgtaacaaaagtctaagaatctctgtgtaaacac |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33690882 |
ggaccacattatatgatttcaatcatttgtcagctgtcattcttatgagaaatccctggattcacgtaacaaaagtctaagaatgtctgtgtaaacac |
33690785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 33691037 - 33690998
Alignment:
| Q |
18 |
catattgcatggctagacattaaattgaagatcctttttt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33691037 |
catattgcatggctagacattaaattgaagatcctttttt |
33690998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University