View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_low_81 (Length: 236)
Name: NF17080_low_81
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_low_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 35614627 - 35614811
Alignment:
| Q |
16 |
ctcttgacatatattttttattttcaaaactcaacatctcgatccttccttttaataaaaatgctctcgatccttcgtttagaaagcaagctctttcac- |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||| |||| ||||| ||||||||||||| ||||||| |||||||||||||||||| ||| |
|
|
| T |
35614627 |
ctcttgacatctattttttattttcaaaactcaatatctcgattcttctttttattaaaaatgctctccatccttcttttagaaagcaagctcttccaca |
35614726 |
T |
 |
| Q |
115 |
--ttacttatactttatatgtatttttaaaatcgtaatactatgttttgaactgttctcatgtcacttatagtaacaaacttaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35614727 |
cattacttatactttatatgtatttttaaaatcgtaatactaggttttgaactgttctcatgtcacttatagtaacaaacttaaa |
35614811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 194 - 236
Target Start/End: Original strand, 35614848 - 35614890
Alignment:
| Q |
194 |
taaataaaataaaacaaagaatgagatgtatctttcaaaaggc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35614848 |
taaataaaataaaacaaagaatgagatgtgtctttcaaaaggc |
35614890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University