View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17080_low_93 (Length: 206)
Name: NF17080_low_93
Description: NF17080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17080_low_93 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 40183565 - 40183375
Alignment:
| Q |
16 |
atcctcaaatcaaacctttctatcaaggccaaaacgtgatgagaaaaacatgtctctaacccaaagaggagaccaagaaagcaaggcaaacaaaccagtc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40183565 |
atcctcaaatcaaacctttctatcaaggccaaaacgtgatgagaaaaacatgtctctaacccaaagaggagaccaagaaagcaaggcaaacaaaccagtc |
40183466 |
T |
|
| Q |
116 |
aagtgaccaaaaataatttgcttaggtggtttatttgccaaaattttattaacaacatgtctagcaaaaactctaccatccgttgcttttc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40183465 |
aagtgaccaaaaataatttgcttaggtggtttatttgccaaaattttattaacaacatgtctagcaaaaactctaccatccgttgcttttc |
40183375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University