View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17081_high_41 (Length: 284)
Name: NF17081_high_41
Description: NF17081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17081_high_41 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 14 - 284
Target Start/End: Original strand, 37157219 - 37157489
Alignment:
| Q |
14 |
atatcggtgttagagaagcttagaagaaaactaaaatttagttatgttgttgcctttgacaattcttggtaaatcaggtgttgcacatggatcaaaatga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37157219 |
atatcggtgttagagaagcttagaagaaaactaaaatttagttatgttgttgcctttgacaattcttggtaaatcaggtgttgcacatggatcaaaatga |
37157318 |
T |
 |
| Q |
114 |
ctactatggaggggcttccacatctcttaatcttacacaggtcactctcctcttatgcagattttcaatagacgcacttaaagtatatatgttttgtttc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37157319 |
ctactatggaggggcttccacatctcttaatcttacacaggtcactctcctcttatgcagattttcaatagacgcacgtaaagtatatatgttttgtttc |
37157418 |
T |
 |
| Q |
214 |
atggtagttctcttttcatatcaaagctcattttctgttgtatagctgtttaagagatcttggggagatga |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| | |||||||||| |
|
|
| T |
37157419 |
atggtagttctcttttcatatcaaagctcattttctgttgtatagctatttaagcgatataggggagatga |
37157489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University