View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17081_high_48 (Length: 250)
Name: NF17081_high_48
Description: NF17081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17081_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 46303746 - 46303527
Alignment:
| Q |
12 |
caaaggcacaaacgagacactaacacatcgacacaagtaaatttttagaatatgaaagtattcaattaaatgtaacgacatgggtcagtgttatttcgag |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46303746 |
caaagacacaaacgagacactaacacatcgacacaagtaaatttttagaatatgaaagtattcaattaaatgtaacgacatgggtcagtgttatttcaag |
46303647 |
T |
 |
| Q |
112 |
cagtgaacacgacttcaatctaaattatgagagatgcatagaatgttaagtaagaggtgacatacatggattgcaagtttcttaaatcaccaattgctgg |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46303646 |
cagtgaacacgacttcaatctaaagtatgagagatgcatagaatgttaagtaagaggtgacatacatggattgcaagtttcttaaatcaccaattgctgg |
46303547 |
T |
 |
| Q |
212 |
tgatatctcaccaccaaggt |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
46303546 |
tgatatctcaccaccaaggt |
46303527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University