View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17081_low_32 (Length: 331)
Name: NF17081_low_32
Description: NF17081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17081_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 8712791 - 8712483
Alignment:
| Q |
1 |
tattagtggtgtttgtattcaatttttcagtgatgagattagaaacttttccacatctaggtttcttcttcttc---gcaatttatgaaaatttttatga |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
8712791 |
tattagtggtgtttgtattcaatttttcagtgatgagattagaaactcttcaacatctaggtttcttcttcttcttcgcaatttatgacaacttttatga |
8712692 |
T |
 |
| Q |
98 |
taattttctttttcatatataatttgatgacaaagttcaatcaattgtgtctatattttaacaataaagcaacaactttgaaacgagatccgactcattt |
197 |
Q |
| |
|
| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8712691 |
tttttttttttttcatatataatttgatgacaaagttcaatcaattgtgtctatattttaacaataaagcaacaactttgaaacgagatccgactcattt |
8712592 |
T |
 |
| Q |
198 |
taacaactataacatgatacatatataacttattgggtaacccaaactctacttgatatataggtgataatcaaacaatattaatctttgtaattaataa |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8712591 |
taacaactataacatgatacatatataacttattgggtaacccaaactctacttgatatataggtgataatcaaacaatattaatctttgtaattaataa |
8712492 |
T |
 |
| Q |
298 |
cctttgcca |
306 |
Q |
| |
|
||||||||| |
|
|
| T |
8712491 |
cctttgcca |
8712483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University