View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17081_low_41 (Length: 299)
Name: NF17081_low_41
Description: NF17081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17081_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 19 - 292
Target Start/End: Complemental strand, 40983967 - 40983694
Alignment:
| Q |
19 |
acttaactgttgaagaaaaggttttagcgcttgcaaaagaaggtatagctctcgacagaaatatgcagctaaaccagagcagtattcacaccctgcttaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40983967 |
acttaactgttgaagaaaaggttttagcgcttgcaaaagagggtatagctctcgacagaaatatgcagctaaaccagagcagtattcacaccctgcttaa |
40983868 |
T |
|
| Q |
119 |
atggggtgcctcttatctgttcagcaagtttgatgatttacatggaagtggcacctcagtctctgcttcaggcatctctgatcagtcaattctaaatgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40983867 |
atggggtgcctcttatctgttcagcaagtttgatgatttacatggaagtggcacctcagtctctgcttcaggcatctctgatcagtcaattctaaatgat |
40983768 |
T |
|
| Q |
219 |
gtaatctgcgaattatcatgcaaattggcttctgatagcaatgccactcattctcatggacagtctttcatatc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
40983767 |
gtaatctgcgaattatcatgcaaattggcttctgatagcgatgccactcattctcacagacagtctttcatatc |
40983694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University