View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17081_low_43 (Length: 284)
Name: NF17081_low_43
Description: NF17081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17081_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 26274731 - 26274494
Alignment:
| Q |
17 |
aaataatgtgcttcccattcttccacacgggatatcgtggccagctctaaataactttcactgtgccgttgattttttaccttatttcgttggtttggtc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26274731 |
aaataatgtgcttcccattcttccacacgggatatcgtggccagctctaaataactttcactgtgccgttgatttgttaccttatttcgttggtttggtc |
26274632 |
T |
 |
| Q |
117 |
actccttccaatgcgtcaattcagtggaaaggagcttgtttctatgaaaatagagggatgcgtaatgaactctctttgggtggtgacattctttatctca |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26274631 |
actccttccaatgcttcaattcagtggaaaggagcttgtttctatgaaaatagagggatgtgtaatgaactctctttgggtggtgacattctctatctca |
26274532 |
T |
 |
| Q |
217 |
gggtattttccccttctttcagtccttaatttacagaa |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26274531 |
gggtattttccccttctttcagtccttaatttatagaa |
26274494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University