View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17081_low_52 (Length: 242)
Name: NF17081_low_52
Description: NF17081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17081_low_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 227
Target Start/End: Original strand, 1862883 - 1863098
Alignment:
| Q |
12 |
atgaagcgtgttattactgatcgagatgttgatatggtaattaatgattttatcactctttagtgatttgaatatgtgaagaattcttcatctttttcca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1862883 |
atgaagcgtgttattactgatcgagatgttgatatggtaattaatgattttatctctctttagtgatttgaatatgtgaagaattcttcatctttttcca |
1862982 |
T |
|
| Q |
112 |
ctgtttctctaaaaaacaatgttttgattagtgtgtaagtaaatatagtcattatttttatctttgccttctttatttcacgtgctcttcttatatttat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1862983 |
ttgtttctctaaaaaacaatgttttgattagtgtgtaagtaaatatagtcattatttttatctttgccttctttatttcacgtgctcttcttatatttat |
1863082 |
T |
|
| Q |
212 |
tttcattataaaaaat |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1863083 |
tttcattataaaaaat |
1863098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University