View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17081_low_53 (Length: 240)
Name: NF17081_low_53
Description: NF17081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17081_low_53 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 33650862 - 33650650
Alignment:
| Q |
18 |
gtttggacaaagtattagtcacactaaaaactcgttgtcctttctcagataaatattttataagaaaaaatctaactttgttgattccacaacaaaaagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33650862 |
gtttggacaaagtattagtcacactaaaaactcgttgtcctttctcacataaatattttataaagaaaaatctaactttgttgattccacaacaaaaagt |
33650763 |
T |
|
| Q |
118 |
agcgtgtgctgccaactgaagttcaataattgggcaatacctttttctttcctagtaaaataagtagaagcacattttaatcaatgatcatattataatc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33650762 |
agcgtgtgctgccaactgaagttcaataattgggcaatacctttttctttcctagtaaaataagtagaagcacgttttaatcaatgatcatattataatc |
33650663 |
T |
|
| Q |
218 |
atgcacaggttct |
230 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
33650662 |
atgcataggttct |
33650650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 230
Target Start/End: Complemental strand, 33635748 - 33635686
Alignment:
| Q |
170 |
tagtaaaataagtagaagcacattttaatca--atgatcatattataatcatgcacaggttct |
230 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| |||||||| |||||| |||||| ||||||| |
|
|
| T |
33635748 |
tagtaaaataaatagaagcacgttttaatcaatatgatcatgttataaccatgcataggttct |
33635686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University