View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17081_low_54 (Length: 229)
Name: NF17081_low_54
Description: NF17081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17081_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 212
Target Start/End: Complemental strand, 27863415 - 27863215
Alignment:
| Q |
12 |
aagcatagggattctcatcactgaacatctgaggaggtggatgactagggtgcatgtaatacggtacttgaggtggctgcataggataaccaccaccatg |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27863415 |
aagcattgggattctcatcactgaacatctgaggaggtggatgactagggtgcatgtaatacggtacttgaggtggctgcataggataaccaccaccatg |
27863316 |
T |
 |
| Q |
112 |
attcatattcatatacccattattctccatataatgttgattattatcataaccaccaccataaccagattgatgatgaaattgatccataccagcataa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27863315 |
attcatattcatatacccattattctccatataatgttgattattatcataaccaccaccataaccagattgatgatgaaattgatccataccagcataa |
27863216 |
T |
 |
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
27863215 |
t |
27863215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University