View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_high_15 (Length: 431)
Name: NF17082_high_15
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 3e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 137 - 271
Target Start/End: Complemental strand, 32854638 - 32854504
Alignment:
| Q |
137 |
gtggacaaagttaaggctttgtttgtttctttttattatccttaagcagacaataggacgatttcactttatttcctggccaaataaccgtcagcaaagg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32854638 |
gtggacaaagttaaggctttgtttgtttctttttattatccttaagcagacaataggacgatttcactttatttcctggccaaataaccgtcagcaaagg |
32854539 |
T |
|
| Q |
237 |
gtcatagcccacccttttccaaagggcaaaggtac |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32854538 |
gtcatagcccacccttttccaaagggcaaaggtac |
32854504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 14 - 83
Target Start/End: Complemental strand, 32854761 - 32854692
Alignment:
| Q |
14 |
tactcttccttctctctcttttttccctttctcaacttgactatattttagtatagtagaaagttcattg |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32854761 |
tactcttccttctctctcttttttccctttctcaacttgactatattttagtatagtagaaagttcattg |
32854692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 336 - 414
Target Start/End: Complemental strand, 32854439 - 32854362
Alignment:
| Q |
336 |
agaaggggacaatcaaaatcagccttattagaacatgatggggattggcttagctcaatcgagatcaatgtgcacatga |
414 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32854439 |
agaaggggacaatcaaa-tcagccttattagagcatgatggggattggcttagctcaatcgagatcaatgtgcacatga |
32854362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University