View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_high_21 (Length: 382)
Name: NF17082_high_21
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 18 - 368
Target Start/End: Complemental strand, 36257912 - 36257562
Alignment:
| Q |
18 |
aatataaggttccaaaacaaggtttctaacgctgcaagagtgctagatagcatcattgttgaggtgacactaattagtacattgcaagggacannnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36257912 |
aatataaggttccaaaacaaggtttctaacgctgcaagagtgctagatcgcatcattgttgaggtgacactaattagtacattgcaagggacatttttta |
36257813 |
T |
|
| Q |
118 |
nnnnnagggaaccttgcaagggacatatgtcctctcatatggcagattttgttgtgttgctggaaaaaccagaaattcatataagatcatcgaagttctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36257812 |
tttttagggaaccttgcaagggacatatgtcctctcatatggcagatttttttgtgttgctggaaaaaccagaaattcatataagatcatcgaagttctt |
36257713 |
T |
|
| Q |
218 |
tgacagccttctgctactagttgggttaaagtgaatacagatgactcttccgtcggcttgccaggcattgcagccattggaggaatatttagggatcata |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36257712 |
tgacagccttctgctactagttgggttaaagtgaatacagatgactcttccgtcggcttgccaggcattgcagccattggaggaatatttagggatcata |
36257613 |
T |
|
| Q |
318 |
gagatgaattcttgggagctttctctcagaacattggacgtcaaaatgctc |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36257612 |
gagatgaattcttgggagctttctctcagaacattggacgtcaaaatgctc |
36257562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University