View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_high_27 (Length: 342)
Name: NF17082_high_27
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 13 - 326
Target Start/End: Complemental strand, 41425781 - 41425462
Alignment:
| Q |
13 |
cagacccaatccctatagacttcactacaagggcacatgttaggacattgcgccgtcaatggaccaaatcatatccctctagtagccaatcactgcatga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41425781 |
cagacccaatccctatagacttcactacaagggcacaggttaggacgctgcgccgtcaatggaccaaatcatatccctctagtagccaatcactgcatga |
41425682 |
T |
 |
| Q |
113 |
tcatcgtcagacagtgatccactaatt-gcgttgataatctctcagtaatgcaatgagaaaggtagacaatcaaatataataaatccatcattctactcg |
211 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41425681 |
tcatcgtcag----tgatccactaatttgctttgataatctctcagtaatgcaatgagaaaggtagacaatcaaatataataaatccatcattctactcg |
41425586 |
T |
 |
| Q |
212 |
acgtcacaatgtttgcagatacatcaccaactctggccgttatctctgatccactccgtatcggtaacta---------gtctcttaacataaaatgtta |
302 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41425585 |
acgtcacaatgtttgcagatgcatcaccaactccgaccgttatctctgatccactccgtatcggtaactaatcaattttgtctcttaacataaaatgtta |
41425486 |
T |
 |
| Q |
303 |
accttcaaatatacatgttgattt |
326 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41425485 |
accttcaaatatacatgttgattt |
41425462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University