View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_high_45 (Length: 270)
Name: NF17082_high_45
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_high_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 5017505 - 5017746
Alignment:
| Q |
20 |
caatggtaatggctggcaagcatttcctgttgcatcggaagctactaccacagcaacacataacttagttcctaatatgttctaccatgctggatacaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017505 |
caatggtaatggctggcaagcatttcctgttgcatcggaagctactaccacagcaacacataacttagttcctaatatgttctaccatgctggatacaca |
5017604 |
T |
|
| Q |
120 |
tttcctggatttccaggtttgtatgcaactttttctcttcagatgacttgtccttactgggatatccaggattgaacataatgatctatactgattgata |
219 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017605 |
tttcccggatttccaggtttgtatgcaactttttctcttcagatgacttgtccttactgggatttccaggattgaacataatgatctatactgattgata |
5017704 |
T |
|
| Q |
220 |
tatcattttgtataaacttttaaaactcatttttagtattat |
261 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5017705 |
tatcattttgtataaactcttaaaactcatttttagtattat |
5017746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 121 - 168
Target Start/End: Original strand, 5005614 - 5005661
Alignment:
| Q |
121 |
ttcctggatttccaggtttgtatgcaactttttctcttcagatgactt |
168 |
Q |
| |
|
||||||| ||||||||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
5005614 |
ttcctggctttccaggtatgtatggaactttttctcttcatatgactt |
5005661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University