View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_high_47 (Length: 269)
Name: NF17082_high_47
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_high_47 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 11 - 269
Target Start/End: Complemental strand, 4284466 - 4284208
Alignment:
| Q |
11 |
cacagacgctacgctctaatagaaggagcgtgaagtaaaagggttttggagtttccagattaggataaaagcaagatgcagcggtttaaccggttatgca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4284466 |
cacagacgctacgctctaatagaaggagcgtgaagtaaaagggttttggagtttccagattaggataaaagcaagatgcagcggtttaaccggttatgca |
4284367 |
T |
 |
| Q |
111 |
gtgaatggtaccccgttatgtccgggttattcaactaagggtagggtagggcccacagttcacaaccacatagttggagggtagtagtaagtagggtact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4284366 |
gtgaatggtaccccgttatgtccgggttattcaactaagggtagggtagggcccacagttcacaaccacatagttggagggtagtagtaagtagggtact |
4284267 |
T |
 |
| Q |
211 |
gtacttcactgactgagccctagacctggctggctctattatactgttgtttctgaggc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4284266 |
atacttcactgactgagccctagacctggctggctctattatactgttgtttctgaggc |
4284208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University