View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_high_49 (Length: 263)
Name: NF17082_high_49
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 43 - 139
Target Start/End: Original strand, 24397432 - 24397527
Alignment:
| Q |
43 |
agaataggctagggcccacataactttgcttgaatagatatgttgtatcactaaaaaagtttaaagtcttggcctttgtttatccctaacttattaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24397432 |
agaataggctagggcccacataactttgcttgaataga-atattgtatcactaaaaaagtttaaagtcttggcctttgtttatccctaacttattaa |
24397527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 162 - 219
Target Start/End: Original strand, 24397550 - 24397606
Alignment:
| Q |
162 |
ggtattaaagtttaatatatgatctattagtctttttaaataagtactttaagataag |
219 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24397550 |
ggtattaa-gtttaaaatatgatctattagtctttttaaataagtactttaaaataag |
24397606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University