View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_high_53 (Length: 250)
Name: NF17082_high_53
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_high_53 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 64 - 250
Target Start/End: Complemental strand, 50515096 - 50514913
Alignment:
| Q |
64 |
acatagaaaatttagagagtatagaacatcattccaaaatgatgtcatgagaactatagcatatgccctttaccccttagcctcctttccttgtctgagg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
50515096 |
acatagaaaatttagagagtatagaacatcattccaaaatgatgtcatgagaactatagcatatgccctttaccccttagcctcttttccttttctgaga |
50514997 |
T |
 |
| Q |
164 |
aaggttgttgcaaccttgtaaccccacttctaatcaattcagcttcttctccagtatgtgatctcatcgtgttaagggccatggtat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
50514996 |
aaggttgttgcaaccttgtaaccccacttctaatcaattcagc---ttctcccgtatgtgatctcattgtgttaagggccatggtat |
50514913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University