View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_high_63 (Length: 239)
Name: NF17082_high_63
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_high_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 43747534 - 43747755
Alignment:
| Q |
1 |
ttaggaaaaatcacattgaaaatagttagaaaagtgacact-agaccttataagttggttttccacagatgaactaggtccaacataaaaatttaataag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
43747534 |
ttaggaaaaatcacattgaaaatagttagaaaagtgacacagagaccttataagttggttttccatggatgaactaggtcgaacataaaaatttaataag |
43747633 |
T |
|
| Q |
100 |
gtattaaggcgcggggtattgtaatgtagccggataatttgctctgaccctatcacttctcgtcaaccaccaaatgtttaaagtcaaagtttactatata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43747634 |
gtattaaggcgcggggtattgtaatgtagccggataatttgctcggaccccatcacttctcgtcaaccaccaaatgtttaaagtcaaagtttactatata |
43747733 |
T |
|
| Q |
200 |
tatggaaaatgcaacactcatc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43747734 |
tatggaaaatgcaacactcatc |
43747755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University