View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_high_64 (Length: 239)
Name: NF17082_high_64
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_high_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 11 - 191
Target Start/End: Complemental strand, 29564235 - 29564055
Alignment:
| Q |
11 |
gcacagtgtctaacgttgttgttattattgtcatttcaaaatctctgttcttcctcttcacgaggttccacgcctagtacttagtaccgcttcttccatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29564235 |
gcacagtgtctaacgttgttgttattattgtcatttcaaaatctctgttcttcctcttcacgaggttgcacgcctagtacttagtaccgcttcttccatt |
29564136 |
T |
 |
| Q |
111 |
tattattactacatacaccttccttcttataaacaaacactcttcgtctttgttacattgcatgagaaaatgtccacacca |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29564135 |
tattattactacatacaccttccttcttataaacaaacactcttcgtctttgttacattgcatgagaaaatgtccacacca |
29564055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University