View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_high_70 (Length: 217)
Name: NF17082_high_70
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_high_70 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 31 - 200
Target Start/End: Complemental strand, 14000841 - 14000672
Alignment:
| Q |
31 |
aaaaacctgaatttgatttggacatcttcggaccaatttttcacccagccacctagttcggtttcaggttcttattttgccacccaatcaaactgaaccg |
130 |
Q |
| |
|
|||||||| |||||| ||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
14000841 |
aaaaacctaaatttggtttggacgtcttcggaccaatttttcacccagccacgtggttcggtttcaggttcttattttgccacccaaccaaaccgaaccg |
14000742 |
T |
 |
| Q |
131 |
tggattcacttaattaaatgtattgaattagtaactcatgaaacactcgactgaactcaaacactcttca |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14000741 |
cggattcacttaattagatgtattgaattagtaactcatcaaacactcgactgaactcaaacactcttca |
14000672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University