View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_low_37 (Length: 294)
Name: NF17082_low_37
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 3 - 110
Target Start/End: Original strand, 48714717 - 48714824
Alignment:
| Q |
3 |
atggcatgcacttcctcattttttatgagatccaaagctgttcatcacaaatttaatgattatgtattctaattgaatcatccgtattttgtcatcttta |
102 |
Q |
| |
|
||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48714717 |
atggcttgcactttttcatttttaatgagatccaaagctgttcatcacaaatttaatgattatgtattctaattgaatcatccgtattttgtcatcttta |
48714816 |
T |
 |
| Q |
103 |
ttatctat |
110 |
Q |
| |
|
|||||||| |
|
|
| T |
48714817 |
ttatctat |
48714824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 48702609 - 48702665
Alignment:
| Q |
1 |
tgatggcatgcacttcctcattttttatgagatccaaagctgttcatcacaaattta |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48702609 |
tgatggcatgcacttcctcattttttatgagatccaaagctgttcatcacaaattta |
48702665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University