View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_low_46 (Length: 276)
Name: NF17082_low_46
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 10793665 - 10793490
Alignment:
| Q |
18 |
ctaagaaggtagtgttaattgagtttattatttaaacataaaaacaaattgatgtggcatccaatgcaatataaagatacactacnnnnnnnaagggaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10793665 |
ctaagaaggtagtgttaattgagtttgttatttaaacataataacaaattgatgtggcatccaatgcaatataaagatacactactttttttaagggaaa |
10793566 |
T |
 |
| Q |
118 |
aatgagatgcaaatggacctcccactgcagtatcataatcatatattaaatgaaagagaaaagtgtaaagaagagg |
193 |
Q |
| |
|
|||||||||||||||||||||| ||| || ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10793565 |
aatgagatgcaaatggacctcctactccaatatcacaatcatatattaaatgaaagagaaaagtgtaaagaagagg |
10793490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University