View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17082_low_52 (Length: 263)

Name: NF17082_low_52
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17082_low_52
NF17082_low_52
[»] chr4 (2 HSPs)
chr4 (43-139)||(24397432-24397527)
chr4 (162-219)||(24397550-24397606)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 43 - 139
Target Start/End: Original strand, 24397432 - 24397527
Alignment:
43 agaataggctagggcccacataactttgcttgaatagatatgttgtatcactaaaaaagtttaaagtcttggcctttgtttatccctaacttattaa 139  Q
    |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24397432 agaataggctagggcccacataactttgcttgaataga-atattgtatcactaaaaaagtttaaagtcttggcctttgtttatccctaacttattaa 24397527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 162 - 219
Target Start/End: Original strand, 24397550 - 24397606
Alignment:
162 ggtattaaagtttaatatatgatctattagtctttttaaataagtactttaagataag 219  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||    
24397550 ggtattaa-gtttaaaatatgatctattagtctttttaaataagtactttaaaataag 24397606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University