View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_low_53 (Length: 262)
Name: NF17082_low_53
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_low_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 237
Target Start/End: Original strand, 49985525 - 49985747
Alignment:
| Q |
11 |
cacagattatgttgatagtgagacttcagattcagaaaagtgaagttggttctaacgatgaatgtgtgactgcaaattttgtaggcgttaggccaaaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
49985525 |
cacagattatgttgatagtgagacttcagattcagaaaagtgaagttggttctaacgatgaatgtgtgactgcaaattttgtaggcattaggcccaaaat |
49985624 |
T |
|
| Q |
111 |
ctgttccctttggttctggcttcgttaagttacaagacatgaaagtttctaattcacaatttatgtacgtattacttaatttttgtagtgtttgctaaga |
210 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49985625 |
ccgttccctttggttctggcttcgttaagttacaagacacgaaagtttctaattcacaatttat----gtattacttaatttttgtagtgtttgctaaga |
49985720 |
T |
|
| Q |
211 |
agcatttacactaaaatgtacaccgga |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
49985721 |
agcatttacactaaaatgtacaccgga |
49985747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University