View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_low_62 (Length: 249)
Name: NF17082_low_62
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 4 - 104
Target Start/End: Complemental strand, 44047914 - 44047814
Alignment:
| Q |
4 |
tgcttcacctgtgattgatttatatgtgactccatctagtacattaagttcttcgcctaaaggatgaatctcctcaccaatatcactatcactttctagt |
103 |
Q |
| |
|
||||||| || ||||| ||||| |||||||||||| | ||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44047914 |
tgcttcatctatgatttgtttatctgtgactccatcaaatacattatgttcttcacctaagggatgaatctcctcaccaatatcactatcactttctagt |
44047815 |
T |
 |
| Q |
104 |
a |
104 |
Q |
| |
|
| |
|
|
| T |
44047814 |
a |
44047814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 177
Target Start/End: Complemental strand, 44047788 - 44047715
Alignment:
| Q |
104 |
atcatccgatggtttaaactttgatggagatgaagga-cactataggattttatcttggaagagttttgattgaa |
177 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||| ||||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
44047788 |
atcatctgatggtttaaactttgatggagatggaggatcactaaaggattttatctttgaag-gttttgattgaa |
44047715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University