View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_low_70 (Length: 238)
Name: NF17082_low_70
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_low_70 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 1491292 - 1491512
Alignment:
| Q |
18 |
acaaaagtatcaatttgtgtgcgtgattttggattaatttggtctactnnnnnnnnnnnnnnnnnnnaatattctgactttattgttggattattctgct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
1491292 |
acaaaagtatcaatttgtgtgcgtgattttggattaatttggtctactttgtgttgttgttgttgttaatattctgactttgttgttggattattctgct |
1491391 |
T |
 |
| Q |
118 |
tgtgattattggggtctctcatttcagctattatcttcgttattcattgcttcactgtagtgatgtttaaaaatgcttccgatttaaattggtgcaacct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1491392 |
tgtgattattggggtctctcatttcagctattatcttcgttattcattgcttcactgtagtgatgtttaaaaatgcttccgatttaaattggtgcaacat |
1491491 |
T |
 |
| Q |
218 |
tgttcatttaatgggctgctc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1491492 |
tgttcatttaatgggctgctc |
1491512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 117 - 224
Target Start/End: Original strand, 1496768 - 1496875
Alignment:
| Q |
117 |
ttgtgattattggggtctctcatttcagctattatcttcgttattcattgcttcactgtagtgatgtttaaaaatgcttccgatttaaattggtgcaacc |
216 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||| || ||| ||||||| | |||| |||||||||| |||||| ||||||| ||||||||| | |
|
|
| T |
1496768 |
ttgtgattattgggttctctcgttttagctattatttttgttgctcattgcatggtagtagggatgtttaaagatgcttttgatttaagttggtgcaatc |
1496867 |
T |
 |
| Q |
217 |
ttgttcat |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
1496868 |
ttgttcat |
1496875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 218
Target Start/End: Original strand, 1509316 - 1509410
Alignment:
| Q |
123 |
ttattggggtctctcatttcagctattatcttcgttattcattgcttcactgtagtgatgtttaaaaatgcttccgatttaaattggtgcaacctt |
218 |
Q |
| |
|
||||||||||||||||||| ||| || || |||||||||||| ||| |||||||| || || |||||| ||| ||||||| || |||||||||| |
|
|
| T |
1509316 |
ttattggggtctctcattttagccatcattatcgttattcatttcttgcctgtagtggtgctt-aaaatgtttctgatttaagttcgtgcaacctt |
1509410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University