View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_low_74 (Length: 226)
Name: NF17082_low_74
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 16 - 182
Target Start/End: Original strand, 8207258 - 8207424
Alignment:
| Q |
16 |
agaagaacttaaagacttaaaacaagttagcaatatatattaaaagcaagcacactnnnnnnnngacaataaaaacatctatccgattataattttttag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8207258 |
agaagaacttaaagacttaaaacaagttagcaatatatattaaaagcaagcacactaaaaaaaagacaataaaaacatctatccgattataattttttag |
8207357 |
T |
 |
| Q |
116 |
tgagagaaattctaacttctctcaacttattttcttctttatttatcgaagagcggctagttttgtg |
182 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
8207358 |
tgagagaaattctaacttccctcaacttattttcttcttcatttatcgaagaggggctagttttgtg |
8207424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University