View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17082_low_75 (Length: 220)
Name: NF17082_low_75
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17082_low_75 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 45945097 - 45944975
Alignment:
| Q |
1 |
gccattgaagcattgaaggctcaaaaacaaccttcttttcaacccactcgtatgaactcctggccaaagtttcattccaaccaaattctcttatgtactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45945097 |
gccattgaagcattgaaggctcaaaaacaaccttcttttcaacccactcgtatgaactcctggccaaagtttcattccaaccaaattctcttatgtactt |
45944998 |
T |
|
| Q |
101 |
ataactagcccttgagtataatc |
123 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
45944997 |
ataactagcccttgagtagaatc |
45944975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 17 - 123
Target Start/End: Complemental strand, 45938317 - 45938211
Alignment:
| Q |
17 |
aggctcaaaaacaaccttcttttcaacccactcgtatgaactcctggccaaagtttcattccaaccaaattctcttatgtacttataactagcccttgag |
116 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| || |||||| || | ||||||||||||||||||||| | ||||||||||| |||| |||||||||||| |
|
|
| T |
45938317 |
aggctcaaaagcaaccttcttttcaatccattcatatgaaatcttagccaaagtttcattccaaccagaatctcttatgtaactatagctagcccttgag |
45938218 |
T |
|
| Q |
117 |
tataatc |
123 |
Q |
| |
|
|| |||| |
|
|
| T |
45938217 |
tagaatc |
45938211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University