View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17083_high_33 (Length: 291)
Name: NF17083_high_33
Description: NF17083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17083_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 275
Target Start/End: Complemental strand, 41398866 - 41398605
Alignment:
| Q |
15 |
ggcggtttattatatccaagtctttataaataaaaagagagactctcaaatagctttcaaactacacaagtacataaatttgactccaaaatataatcat |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41398866 |
ggcgctttattatatccaagtctttataaataaaaagagagactctcaaatagctttcaaactacacaagtacataaatttgactccaaaatataatcat |
41398767 |
T |
 |
| Q |
115 |
gatttctttaagtcacaatctctctattaaaaaacattgtacataataatcaccagaccaaactgggcaagcagcaggatca-nnnnnnnncttcataag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
41398766 |
gatttctttaagtcacaatctctctattaaaaaacattgtacataataatcactagaccaaactgggcaagcagcaggatcatttttttttcttcacaag |
41398667 |
T |
 |
| Q |
214 |
aaaataaattaaaaaaggtcaagcagaatcatttagaaattatgattggttcaggagaatat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41398666 |
aaaataaattaaaaaaggtcaagcagaatcatttagaaattatgattggttcaggagaatat |
41398605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University