View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17083_high_35 (Length: 285)
Name: NF17083_high_35
Description: NF17083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17083_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 128 - 266
Target Start/End: Complemental strand, 24287476 - 24287336
Alignment:
| Q |
128 |
atgaatgtgactctgtactttataggataatcaacaaaacaataatatcttgcaaaatcatatggtttaatcatctcaacgactcctttcatacaacaat |
227 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24287476 |
atgaacgtgactctgtacttcataggataatcaacaaaacaataatatctcgcaaaatcatatggtttaatcatctcaaagactcctttcatacaacaat |
24287377 |
T |
|
| Q |
228 |
ttttcaacaattatattgttcta--aaaattttccactgtc |
266 |
Q |
| |
|
||| ||||||||||||||||||| || ||||||||||||| |
|
|
| T |
24287376 |
tttccaacaattatattgttctaacaatattttccactgtc |
24287336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 15 - 74
Target Start/End: Complemental strand, 24287589 - 24287530
Alignment:
| Q |
15 |
aatggctgggattaaaaatccacttaaaatgtcacgtgcccactggtgttgttcagcgtg |
74 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24287589 |
aatggctgggattaaaactccacttaaaatgtcacgtgcctactggtgttgttcagcgtg |
24287530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 128 - 248
Target Start/End: Complemental strand, 32993885 - 32993765
Alignment:
| Q |
128 |
atgaatgtgactctgtactttataggataatcaacaaaacaataatatcttgcaaaatcatatggtttaatcatctcaacgactcctttcatacaacaat |
227 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32993885 |
atgaacgtgactctgtacttcataagataatcaacaaaacaataatatctcgcaaaatcatatggtttaatcatctcaaagactcctttcatacaacaat |
32993786 |
T |
|
| Q |
228 |
ttttcaacaattatattgttc |
248 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
32993785 |
tttccaacaattatattgttc |
32993765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 15 - 74
Target Start/End: Complemental strand, 32993998 - 32993939
Alignment:
| Q |
15 |
aatggctgggattaaaaatccacttaaaatgtcacgtgcccactggtgttgttcagcgtg |
74 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32993998 |
aatggctgggattaaaactccacttaaaatgtcacgtgcccactggtgttgttcagcgtg |
32993939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University