View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17083_high_50 (Length: 237)
Name: NF17083_high_50
Description: NF17083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17083_high_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 29783607 - 29783423
Alignment:
| Q |
1 |
ttgcctcataagatcctatgggttccaatgcattcagagctatccaaaatgtttcaccaaatagaataaccttttagtttataattacaatttacaagga |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29783607 |
ttgcttcataagatcctatgggttccaatgcattcagagctatccaaaatgtttcaccaaatagaataaccttttagtttataattacaatttacaagga |
29783508 |
T |
 |
| Q |
101 |
gccgaactttattttatgatatgaaatgggtacactttgttaggagataagaatctgaattattttctaataatttggtggatta |
185 |
Q |
| |
|
||| ||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29783507 |
gccaaactttattttatgacatgaaatgggtgctttttgttaggagataagaatctgaattattttttaataatttggtggatta |
29783423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 44
Target Start/End: Complemental strand, 29778920 - 29778882
Alignment:
| Q |
6 |
tcataagatcctatgggttccaatgcattcagagctatc |
44 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
29778920 |
tcataagatcctatgggttccattggattcagagctatc |
29778882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University