View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17083_low_41 (Length: 259)
Name: NF17083_low_41
Description: NF17083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17083_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 36361223 - 36360994
Alignment:
| Q |
13 |
aaaattgaaggctaaaatcgtgcatttgtgatacttcaaaggaggaaaatgtaattaagtcataatattattttcaaaaattattattgtgactatgttc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
36361223 |
aaaattgaaggctaaaatcgtgcatttgtgatacttcaaaggaggaaaatgcaattaagtcttaatattattttcaaaaattatttttgtgactatattc |
36361124 |
T |
|
| Q |
113 |
ttcctttaagagcctataaagttgatgcacgcacacaaaaatcacataaataaatcccatttatggagcaaacgttgtatggaggaaaatgaagagtggt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
36361123 |
ttcctttaagagcctataaagttgatgcacgcacaaataaatcacataaataaatcccatttatggagcaaacgttgtatggaggaaaaggaagtgtggt |
36361024 |
T |
|
| Q |
213 |
atagggactttgggcatttcgtctcaatct |
242 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
36361023 |
atagagactttgggcatttcgtctcaatct |
36360994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University